View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19214_low_18 (Length: 250)
Name: NF19214_low_18
Description: NF19214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19214_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 16 - 152
Target Start/End: Complemental strand, 144034 - 143884
Alignment:
| Q |
16 |
atgaggcgttttccattgagggaaaatgagatgaggttaaagatcaaacatattacatatgcgagaagaaaacaacaacgaagcataa------------ |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
144034 |
atgaggcgttttccattgagggaaaatgagatgaggttaaagatcaaacatattacatatgcgagaagaaaacaacaacgaagcataagcgtgagatgct |
143935 |
T |
 |
| Q |
104 |
--acaacaatgatagtgtttaattcgtatagatggaagtcctattttcaca |
152 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
143934 |
atgctacaatgatagtgtttaattcgtatagatggaagtcctattttcaca |
143884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 168 - 202
Target Start/End: Complemental strand, 143886 - 143852
Alignment:
| Q |
168 |
acaacggcaaagaattctacatgtgaaaatcaatt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
143886 |
acaacggcaaagaattctacatgtgaaaatcaatt |
143852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University