View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19214_low_21 (Length: 234)

Name: NF19214_low_21
Description: NF19214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19214_low_21
NF19214_low_21
[»] chr4 (1 HSPs)
chr4 (17-234)||(35278985-35279202)


Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 234
Target Start/End: Complemental strand, 35279202 - 35278985
Alignment:
17 atatatgtctacttttgcactttctgagaatcttgatattgcaacaaaatgcagacaaatgtagttgaagcgcaaatgcagcttataatatagattctta 116  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
35279202 atatatgtctacttttgcactttctgcgaatcttgatattgcaacaaaatgcagacaaatgtagttgaagcgcaaatccagcttataatatagattctta 35279103  T
117 agcttgtatgattatgttttgcaaagggtgatggtgataacaacggatacatattcagatcttctgcatattcttttctttcttctaatatcattcatta 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
35279102 agcttgtatgattatgttttgcaaagggtgatggtgataacaacggatacatattcagatcttctgcatattcttttctttcttctaatatcattcattt 35279003  T
217 ctttgactgattatttaa 234  Q
    ||||||||||||||||||    
35279002 ctttgactgattatttaa 35278985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University