View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19216_high_27 (Length: 273)
Name: NF19216_high_27
Description: NF19216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19216_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 25586048 - 25585779
Alignment:
| Q |
1 |
ccatatctaaagcattgaaatctggaagattttcactagacaaaattcagaatggctcttttatttcaatccattccaattagagaaaatctacctacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25586048 |
ccatatctaaagcattgaaatctggaagattttcactagacaaaattcagaatggctcttttatttcaatccattccaattagagaaaatctacctacat |
25585949 |
T |
 |
| Q |
101 |
caacagccattgctaccattagttagttgaataaatacctaagaatttcttcggc--tgtgaaatatttctcaattattatgagaccagctgttttttat |
198 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25585948 |
caacagccattgctagcattagttagttgaataaatacctaagagtttcttcagctgtgtgaaatatttctcaattattatgagaccagctgttttttat |
25585849 |
T |
 |
| Q |
199 |
gtacatcgatgacaactatagaagaaagtaagggatcagatgctccactaatatcagcacctttgcttct |
268 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25585848 |
gtacattgcagacaactatagaagaaagtaagggatcagatgctccactaatatcagcacctttgcttct |
25585779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 209 - 261
Target Start/End: Complemental strand, 25600373 - 25600321
Alignment:
| Q |
209 |
gacaactatagaagaaagtaagggatcagatgctccactaatatcagcacctt |
261 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25600373 |
gacaactatcgaagaaagtaagggatcagatgctccactaatatcagcacctt |
25600321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 209 - 261
Target Start/End: Complemental strand, 25590721 - 25590669
Alignment:
| Q |
209 |
gacaactatagaagaaagtaagggatcagatgctccactaatatcagcacctt |
261 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25590721 |
gacaactatcgaggaaagtaagggatcagatgctccactaatatcagcacctt |
25590669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University