View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19216_high_34 (Length: 251)
Name: NF19216_high_34
Description: NF19216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19216_high_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 14568406 - 14568567
Alignment:
| Q |
1 |
attcttcaatgggtttcccgtttggtggtgggaaattttggttgccaagtccatctgcaccatggacagagtccctaatgtcaagttttgtctctttctg |
100 |
Q |
| |
|
||||||||| |||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| | ||||||||| |||||||| |
|
|
| T |
14568406 |
attcttcaaggggttttccatttggtggtggaaaattttggttgccaagtccatctgcaccatggacagaatccctaatatgaagttttgtttctttctg |
14568505 |
T |
|
| Q |
101 |
tagaagtgaaacgagtgaaaataattagtcaagtcaaatatcaagttatactacagatcaac |
162 |
Q |
| |
|
|| |||||||| |||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
14568506 |
taaaagtgaaatgagtgaaaataattagtcaagtcaaataccaagttatactacatatcaac |
14568567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 14576109 - 14576176
Alignment:
| Q |
1 |
attcttcaatgggtttcccgtttggtggtgggaaattttggttgccaagtccatctgcaccatggaca |
68 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14576109 |
attcttcaatgggtttcccatttggtggtggaaaattttggttgccaagtccatctgcaccatggaca |
14576176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University