View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19216_low_42 (Length: 238)

Name: NF19216_low_42
Description: NF19216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19216_low_42
NF19216_low_42
[»] chr8 (1 HSPs)
chr8 (9-221)||(33564295-33564504)
[»] chr5 (1 HSPs)
chr5 (91-147)||(34945882-34945938)


Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 9 - 221
Target Start/End: Complemental strand, 33564504 - 33564295
Alignment:
9 tgaaacaaagaaaatgcaaacttagaaggatgaaatcataatgaaatcaatagagggaataattggtagtggccaagaacgagcaaacaatattgcaggt 108  Q
    ||||||||||||||||||||||||||| |||||| |||||||||||||||||||| ||||||| ||||| |||| |||||||||||||||||||||||||    
33564504 tgaaacaaagaaaatgcaaacttagaaagatgaattcataatgaaatcaatagagtgaataataggtagcggccgagaacgagcaaacaatattgcaggt 33564405  T
109 aatgagtcagaatttctaagtaaaattgcaacgaggaatccctaaactgatattctaatttacgattagagnnnnnnnnngtaaattgcaaacaaaaccc 208  Q
    |||||||||||||||||||| ||||||||||||||||||  ||||| ||||||||||||||||||||||||         ||||||||||||||||||||    
33564404 aatgagtcagaatttctaagcaaaattgcaacgaggaat-tctaaattgatattctaatttacgattagag--tttttttgtaaattgcaaacaaaaccc 33564308  T
209 actttcttttttg 221  Q
    |||||||||||||    
33564307 actttcttttttg 33564295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 91 - 147
Target Start/End: Original strand, 34945882 - 34945938
Alignment:
91 gcaaacaatattgcaggtaatgagtcagaatttctaagtaaaattgcaacgaggaat 147  Q
    |||||||| ||  ||| |||||||||| || |||||||| |||||||||||||||||    
34945882 gcaaacaaaatcacagataatgagtcaaaaattctaagtcaaattgcaacgaggaat 34945938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University