View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19216_low_44 (Length: 221)
Name: NF19216_low_44
Description: NF19216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19216_low_44 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 14 - 200
Target Start/End: Original strand, 28519661 - 28519845
Alignment:
| Q |
14 |
gaagaatattagggagggtagccttttaccgcagaggattcctactaaaaaatatctatgannnnnnncatattgatcaactgacatgaggctttagcaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28519661 |
gaagaatattagggagggtagccttt-accgtaggggattcctactaaaaaatatctatgatttttt-catattgatcaactgacatgaggctttagcaa |
28519758 |
T |
|
| Q |
114 |
aagtatccagaatatctttcaaatctttgtttcagactcatttgctctaaacaaaagaaagctatgatttgcatataagagatgact |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| | ||||||||||||| |
|
|
| T |
28519759 |
aagtatccagaatacctttcaaatctttgtttcagactcatttgctctaaataaaagaaagctatcatttgaaaataagagatgact |
28519845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University