View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19216_low_46 (Length: 215)
Name: NF19216_low_46
Description: NF19216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19216_low_46 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 11 - 142
Target Start/End: Complemental strand, 40033551 - 40033420
Alignment:
| Q |
11 |
cacagagagcttgaccacattagactccacatatagaacaactctacatcaagactatcttcttctctagttgcagggctttggttgacagccaattcca |
110 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
40033551 |
cacagagagcttgaccacattagattccacatatagaacaactctacatcaagactatcttcttctctagttgcggggctttgcttgacagtcaattccc |
40033452 |
T |
|
| Q |
111 |
tttccttctcaacactatcaatctccttacca |
142 |
Q |
| |
|
||||||||||| || ||||||||||||||||| |
|
|
| T |
40033451 |
tttccttctcagcattatcaatctccttacca |
40033420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University