View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19218_high_20 (Length: 255)
Name: NF19218_high_20
Description: NF19218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19218_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 156 - 245
Target Start/End: Complemental strand, 23251977 - 23251888
Alignment:
| Q |
156 |
tagccccatatatgaatgctgaaaaaattgatcaaagttacattatactccactgtatctgaatcttcaatctcatcatgcttctttctt |
245 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23251977 |
tagcccaatatatgaatgttgaaaaaattgatcaaagttacattatactccactgtatctgaatcttcaatctcatcatgcttctttctt |
23251888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 19 - 151
Target Start/End: Complemental strand, 38459459 - 38459309
Alignment:
| Q |
19 |
atgtaaatgctttattaatttcgaactggtataataactgttctt------------------tttatttgttttggatttggttatgattttagagcta |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38459459 |
atgtaaatgctttattaatttcgaactcgtataataactgttcttttatgttttgtcacttcatttatttgttttggatttggttatgattttagagcta |
38459360 |
T |
 |
| Q |
101 |
gattggagtgaggtactcttctacttctattagttttctgttatttatagt |
151 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
38459359 |
gattggagtgaggtggtcttttacttctattagttttctgttatttatagt |
38459309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University