View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19218_high_22 (Length: 249)
Name: NF19218_high_22
Description: NF19218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19218_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 44 - 235
Target Start/End: Complemental strand, 40620158 - 40619967
Alignment:
| Q |
44 |
tcaattggtatgtgttgtttatgacatgtttgatgataagacctcgannnnnnnnnnnnnnnnngtaaagactaaaattgttaccgaaaatattgcgagg |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40620158 |
tcaattggtatgtgttgtttatgacatgtttgatgataagacctcgattttttattttatttttgtaaagactaaaattgttaccgaaaatattgcgagg |
40620059 |
T |
 |
| Q |
144 |
attaaaatttgaagaaaagttgaatgcggactattttctttgttgttgaaatgttatagagtaaaaaacacttttaacttttttgataatat |
235 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40620058 |
attaaaatttgaagaaaagttgtatgcggactattttctttgttgttgaaatgttatagagtaaaaaacacatttaacttttttgataatat |
40619967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University