View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19218_high_32 (Length: 220)
Name: NF19218_high_32
Description: NF19218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19218_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 26235228 - 26235027
Alignment:
| Q |
1 |
gcacccaaaagcactatacagaccataacaagtaccgatcactgtccacgggcatgcaataaggagaccaaatgataatgcaagcatatacaaagaagta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26235228 |
gcacccaaaagcactatacagaccataacaagtaccgatcactgtccacgggcatgcaataaggagaccaaatgataatgcaagcatatacaaagaagta |
26235129 |
T |
 |
| Q |
101 |
gtaaatgttcttttcatgattgatatgtcattggagttttgaaacatgtgtttgatactcatgagactcgtgtcgttgtgattctcttctgaactcaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26235128 |
gtaaatgttcttttcatgattgatatgtcattggagttttgaaacatgtgtttgatactcatgagactcgtgtcgttgtgattctcttctgaactcaatt |
26235029 |
T |
 |
| Q |
201 |
tt |
202 |
Q |
| |
|
|| |
|
|
| T |
26235028 |
tt |
26235027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 54 - 162
Target Start/End: Complemental strand, 37672850 - 37672742
Alignment:
| Q |
54 |
atgcaataaggagaccaaatgataatgcaagcatatacaaagaagtagtaaatgttcttttcatgattgatatgtcattggagttttgaaacatgtgttt |
153 |
Q |
| |
|
|||||||||| |||| | |||||||||||| ||||||||||||| ||||||||| ||||||| |||| | ||| | || ||||||||||||||||| |
|
|
| T |
37672850 |
atgcaataagaagacaatttgataatgcaagtgtatacaaagaagtgataaatgttcctttcatggttgacacatcaattgaattttgaaacatgtgttt |
37672751 |
T |
 |
| Q |
154 |
gatactcat |
162 |
Q |
| |
|
|| |||||| |
|
|
| T |
37672750 |
gagactcat |
37672742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University