View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19218_low_25 (Length: 240)

Name: NF19218_low_25
Description: NF19218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19218_low_25
NF19218_low_25
[»] chr1 (1 HSPs)
chr1 (1-198)||(7339730-7339927)


Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 7339927 - 7339730
Alignment:
1 tatgatggttcgatctaggaagctagactgaacttctcaccttgtcctttgacgagtttgacaaattgacgtgttgatcaattattacaacaacaaaatt 100  Q
    |||||| ||||||| ||||||||| |||||||||||||||||||||  ||||||||||||||||||||||||||||||| ||||||||||||| ||||||    
7339927 tatgatagttcgatttaggaagctggactgaacttctcaccttgtcaattgacgagtttgacaaattgacgtgttgatcgattattacaacaaaaaaatt 7339828  T
101 gaacatattaattcaataattgttgcaaaaacaataaaactcttaatttatattgggctataactagaaaatgtgctaaagagctaacaaataattga 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7339827 gaacatattaattcaataattgttgcaaaaacaataaaactcttaatttatattgggctataactagaaaatgtgctaaagagctaacaaataattga 7339730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University