View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19218_low_31 (Length: 225)
Name: NF19218_low_31
Description: NF19218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19218_low_31 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 36009401 - 36009180
Alignment:
| Q |
1 |
catatctctctcattgacacctctttaataacatatgttttccactcgttttgttctccttaattaactcgtttaccattgtgttttgcatccctgtcgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36009401 |
catatctctctcattgacacctctttaataacatatgttttccactcgtttcgttctccttaattaactcgtttaccatcgtgttttgcatccctgtcga |
36009302 |
T |
 |
| Q |
101 |
tatgacacttgtcgcataggctctcccatcgtgcctaattcagattaattaagaaccaaaaagtaacttaagaatcaaaattgtaatttattcaaaatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36009301 |
tatgacacttgtcgcataggctctcccatcgtccctaattcagattaattaagaaccaaaaagtaacttaagaatcaaaattgtaatttattcaaaat-- |
36009204 |
T |
 |
| Q |
201 |
aataagttaaaacaccaaacttcaa |
225 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36009203 |
-ataagttaaaacaccaaacttcaa |
36009180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 73 - 125
Target Start/End: Complemental strand, 18055130 - 18055078
Alignment:
| Q |
73 |
ttaccattgtgttttgcatccctgtcggtatgacacttgtcgcataggctctc |
125 |
Q |
| |
|
||||||| |||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
18055130 |
ttaccatcatgtttttcatccccgtcggtacgacacttgtcgcataggctctc |
18055078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University