View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19219_high_15 (Length: 289)
Name: NF19219_high_15
Description: NF19219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19219_high_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 9e-73; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 18 - 184
Target Start/End: Complemental strand, 26313182 - 26313016
Alignment:
| Q |
18 |
atattcattataaatcacactttgtttcaaacatttagttggaacaagagtgattggagcacaactacgtagaactttgccctaggttgcgcgactacgt |
117 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
26313182 |
atattcattataaatcacactttatttcaaacatttagttggaacaagagtggttggagcacaactacgcgtaactttgccctaggatgcgcgactacgt |
26313083 |
T |
 |
| Q |
118 |
taaacttcgacggaggccaaaatgtcttagccttgatttgaggttcggtcgtatggttgatctaaga |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26313082 |
taaacttcgacggaggccaaaatgtcttagccttgatttgaggttcggtcgtatggtcgatctaaga |
26313016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 184 - 270
Target Start/End: Complemental strand, 26312917 - 26312831
Alignment:
| Q |
184 |
atgtatttcttgatctcttcctatcccattgttgataaatatgttttgctacttcaaagaacattaatcatgcttttatatacttaa |
270 |
Q |
| |
|
||||| |||||||||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26312917 |
atgtaattcttgatctcttcctattccattattgataaatattttttgctacttcaaagaacattaatcatgcttttatatacttaa |
26312831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University