View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19219_high_24 (Length: 239)
Name: NF19219_high_24
Description: NF19219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19219_high_24 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 16 - 239
Target Start/End: Complemental strand, 34329868 - 34329645
Alignment:
| Q |
16 |
aattcatcttcaacaacaacaaaactcaaaaacggcatcgttttggaagatccaccgagagagtcactggaggttttccgaccaccggaagaactcaccg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34329868 |
aattcatcttcaacaacaacaaaactcaaaaacggcatcgttttggaagatccaccgagagagtcactggaggttttccgaccaccggaagaactcaccg |
34329769 |
T |
|
| Q |
116 |
tcgatactaaaaccctcaatttccaattcccgccgggtatatcacgaatcgtaatcgatgataacgacgcggctagtgatgctagctccgatttgttcga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34329768 |
tcgatactaaaaccctcaatttccaattcccgccgggtatatcacgaatcgtcatcgatgataacgacgcggctagtgatgctagctccgatttgttcga |
34329669 |
T |
|
| Q |
216 |
aatcgaaagcttctcaactgcaac |
239 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
34329668 |
aatcgaaagtttctcaactgcaac |
34329645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University