View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19219_high_25 (Length: 235)
Name: NF19219_high_25
Description: NF19219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19219_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 224
Target Start/End: Original strand, 6943714 - 6943920
Alignment:
| Q |
18 |
aaatcccccttttccaacaattctcattatcccataacaatggaaggtagttgtaacggtgttttttgtctcaaaggtttgtgtttgtataatagttgtg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
6943714 |
aaatcccccttttccaacaattctcattatcccataacaatggaaggtatttgtaacggtgttttttgtctcaaaggtttctgttggtataatagttgtg |
6943813 |
T |
 |
| Q |
118 |
taaatgagttagccatctttaacccgacaactagagaggtccttcgtatccctcacacctgctacctcagtaatggatcatacttgtatggtttcggtgc |
217 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6943814 |
taaatgagttagccatcttgaacccgacaactagagaggtccatcgtatccctcacacctgctacctcagtaatggatcatacttgtatggtttcggtgc |
6943913 |
T |
 |
| Q |
218 |
tgatgat |
224 |
Q |
| |
|
||||||| |
|
|
| T |
6943914 |
tgatgat |
6943920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University