View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19219_high_26 (Length: 228)
Name: NF19219_high_26
Description: NF19219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19219_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 18 - 213
Target Start/End: Original strand, 14160003 - 14160195
Alignment:
| Q |
18 |
ccttgttgtattgtcgttttcttctttgaattgttgtggaatttataaagttagcaacnnnnnnnnttgaaccaaattgtatatggggaaaagtgtagaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14160003 |
ccttgttgtattgtcgttttcttctttgaattgttgtggaatttataaagttagcaacaaaaaaaattgaaccaaattgtatatggggaaaagtgtagaa |
14160102 |
T |
 |
| Q |
118 |
tagaagctgcagcagggtgaggatttttagttaaacgacgaaacaacatgcagggtgtgaggatttttagttactatacttgtatgtatatctgtg |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14160103 |
tagaagctgcag---ggtgaggatttttagttaaacgacgaaacaacatgcaggatgtgaggatttttagttactatacttgtatgtatatttgtg |
14160195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University