View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19219_low_11 (Length: 334)
Name: NF19219_low_11
Description: NF19219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19219_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 62 - 317
Target Start/End: Original strand, 13213753 - 13214006
Alignment:
| Q |
62 |
ccaaggaatcggatcgatgatgggtttgatattggtaagaaagacagcgtgcgcatgggcggtgttgtgggacctacaaagtgggtcccatttattcaag |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13213753 |
ccaaggaatcggatcgatgatgggtttgatattggtaagaaagacagcgtgcgcatgggcggtgttgtgggacctacaaagtgggtcccatatattcaa- |
13213851 |
T |
|
| Q |
162 |
actactaccatgcttgaaatttctctctc-cttataactagtgtctttgtaaatgtttgtgtatgtgtaagtttcttcttctatattggaaaagctgcaa |
260 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13213852 |
--tactaccatgcttgaaatttctctctctcttataactagtgtctttgtaaatgtttgtgtatgtgtaagtttcttcttctatattggaaaagctgcaa |
13213949 |
T |
|
| Q |
261 |
ataagaacacattaatatatgtctttcactaatagggtaaaaaaccttactcactat |
317 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13213950 |
ataagaacacattaatatatgtcttacactaatagggtaaaaaaccttactcactat |
13214006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University