View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19219_low_20 (Length: 255)
Name: NF19219_low_20
Description: NF19219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19219_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 354107 - 353996
Alignment:
| Q |
1 |
cttcaaccttcaacagatcagacataaccaactgcgggtccgagtttctgagtcttttgatcaagcttctttgttatagtggcaaacttaaccttcaaaa |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
354107 |
cttcaaccttcaatagatcagacataaccaactgcgggtccgagtttctgagtcttctgatcaagcttctttgttatagtggcaaacttaaccttcaaaa |
354008 |
T |
|
| Q |
101 |
acaaacatcaca |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
354007 |
acaaacatcaca |
353996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University