View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19219_low_20 (Length: 255)

Name: NF19219_low_20
Description: NF19219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19219_low_20
NF19219_low_20
[»] chr7 (1 HSPs)
chr7 (1-112)||(353996-354107)


Alignment Details
Target: chr7 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 354107 - 353996
Alignment:
1 cttcaaccttcaacagatcagacataaccaactgcgggtccgagtttctgagtcttttgatcaagcttctttgttatagtggcaaacttaaccttcaaaa 100  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
354107 cttcaaccttcaatagatcagacataaccaactgcgggtccgagtttctgagtcttctgatcaagcttctttgttatagtggcaaacttaaccttcaaaa 354008  T
101 acaaacatcaca 112  Q
    ||||||||||||    
354007 acaaacatcaca 353996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University