View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1921_low_5 (Length: 273)
Name: NF1921_low_5
Description: NF1921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1921_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 17 - 262
Target Start/End: Complemental strand, 10441540 - 10441295
Alignment:
| Q |
17 |
cttccttggagaacaacgttgaatgatgaacatgaagaagaagaagttgaaaaaagagcttatggtgtttgggtttctgaggttatgttacagcaaacaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10441540 |
cttccttggagaacaacgttgaatgatgaacatgaagaagaagaagttgaaaagagagcttatggtgtttgggtttcagaggttatgttacagcaaacaa |
10441441 |
T |
|
| Q |
117 |
gggttcagactgttattgcttactttaaccgttggatgcttaaatggcccaccattcatcatctcgctaaggcttctcttgaggttcattttcattcatt |
216 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10441440 |
gggttcagactgttattgcttattttaaccgttggatgcttaaatggcccaccattcatcatctcgctaaggcttctcttgaggttcattttcattcatt |
10441341 |
T |
|
| Q |
217 |
ccttttccctttttgtttgtaaaaattgttcttttatagtcaaaat |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10441340 |
ccttttccctttttgtttgtaaaaattgttcttttatagtcaaaat |
10441295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University