View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19222_high_7 (Length: 243)
Name: NF19222_high_7
Description: NF19222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19222_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 16 - 241
Target Start/End: Complemental strand, 31668209 - 31667984
Alignment:
| Q |
16 |
catcgatctgggcctttggattatggtgctaggctcaaattctggcattactggacccagtccacttgctagatttgcagtatctagatctggtccatta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31668209 |
catcgatctgggcctttggattatggtgctaggatcaaattctggcattactggacccagtccacttgctagatttgcagtatctagatctggtccatta |
31668110 |
T |
 |
| Q |
116 |
gcatacaagtagtaagtttgaaatacccaacatgagctggtaaattattcacctctttctagtgatcagttgtccataaccataaatcatccagcaggtt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31668109 |
gcatacaagtagtaagtttgaaatacccaacatgagctggtaaattattcacctctttctagtgatcagttgtccataaccataaatcatccagcaggtt |
31668010 |
T |
 |
| Q |
216 |
cccacaatatttttatgatgtatatc |
241 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
31668009 |
cccacaatatttttatgatgtatatc |
31667984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 16 - 241
Target Start/End: Complemental strand, 31685263 - 31685038
Alignment:
| Q |
16 |
catcgatctgggcctttggattatggtgctaggctcaaattctggcattactggacccagtccacttgctagatttgcagtatctagatctggtccatta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31685263 |
catcgatctgggcctttggattatggtgctaggatcaaattctggcattactggacccagtccacttgctagatttgcagtatctagatctggtccatta |
31685164 |
T |
 |
| Q |
116 |
gcatacaagtagtaagtttgaaatacccaacatgagctggtaaattattcacctctttctagtgatcagttgtccataaccataaatcatccagcaggtt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31685163 |
gcatacaagtagtaagtttgaaatacccaacatgagctggtaaattattcacctctttctagtgatcagttgtccataaccataaatcatccagcaggtt |
31685064 |
T |
 |
| Q |
216 |
cccacaatatttttatgatgtatatc |
241 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
31685063 |
cccacaatatttttatgatgtatatc |
31685038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 48 - 194
Target Start/End: Original strand, 32796148 - 32796294
Alignment:
| Q |
48 |
gctcaaattctggcattactggacccagtccacttgctagatttgcagtatctagatctggtccattagcatacaagtagtaagtttgaaatacccaaca |
147 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32796148 |
gctcaaattctggcagtaccggacccagtccacttcctagatttgcagtatctagatctggtccattagcatacaagtagtaagtttgaaatacccaaca |
32796247 |
T |
 |
| Q |
148 |
tgagctggtaaattattcacctctttctagtgatcagttgtccataa |
194 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32796248 |
tgagctggtaaattattcacatctttctagtgatcagttgtccataa |
32796294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University