View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19223_low_1 (Length: 451)
Name: NF19223_low_1
Description: NF19223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19223_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 377; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 377; E-Value: 0
Query Start/End: Original strand, 18 - 414
Target Start/End: Original strand, 54097849 - 54098245
Alignment:
| Q |
18 |
gtaataagcaacatctgctcagctgtatatgaattttgtaggtgggcaaagctgctggagcaaaatggaagtcattgtccgaagctgtatgtcctgttat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
54097849 |
gtaataagcaacatctgctcagctgtatatgaattttgtaggtgggcaaagctgctggagcaaaatggaagtcattgtctgaagctgtatgtactgttat |
54097948 |
T |
|
| Q |
118 |
atatttattgtttgtaatttgtttttacaataaccattttatgctgtgattgaacgtttggtctctgaattttattaggagaaagcaccatatgcagcaa |
217 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54097949 |
atatttattggttgtaatttgtttttacaataaccattttatgctgtgattgaacgtttggtctctgaattttattaggagaaagcaccatatgcagcaa |
54098048 |
T |
|
| Q |
218 |
aagcagagaaaaggaaggcagaatatgagaaaaccatgaaggcatataacaagaaacaggtgggagaaacttctgctgcggtaagtaaatgcaaattggg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
54098049 |
aagcagagaaaaggaaggcagaatatgagaaaaccatgaaggcatataacaagaaacaggtgggtgaaacttctgctgctgtaagtaaatgcaaattggg |
54098148 |
T |
|
| Q |
318 |
taagtaggtttttgatgatttatttgtgattgttgtcaggctgaaggtccagctgctgttgaggaagaagaatctgggaaatcagaatctgaagtgc |
414 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54098149 |
taagtaggtttttgatgatttatttgtgattgttgtcaggctgaaggtccagctgctgttgaggaagaagaatctgggaaatcagaatctgaagtgc |
54098245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University