View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19224_low_9 (Length: 234)
Name: NF19224_low_9
Description: NF19224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19224_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 20 - 222
Target Start/End: Complemental strand, 36610758 - 36610556
Alignment:
| Q |
20 |
acgcagtaccatgtaaaattttatgagcccaaaaactcaattgtttaaaattctttatgttcattttctcttcaaatcttttcagagcagcattgatgaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36610758 |
acgcagtaccatgtaaaattttatgagcccaaaaactcaattgtttaaaattctttatgttcgttttctcttcaaatcttttcagagcagcattgatgaa |
36610659 |
T |
|
| Q |
120 |
aaaatcgaatggggcttactttcctgaagaggtattcttgtttatactttgactttcttaaattttgtatatttgttaaatattttgcttgctcatgttg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36610658 |
aaaatcgaatggggcttactttcctgaagaggtattcttgtttatactttgactttcttaaattttgtatatttgttaaatattttgcttgctcatgttg |
36610559 |
T |
|
| Q |
220 |
ata |
222 |
Q |
| |
|
||| |
|
|
| T |
36610558 |
ata |
36610556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University