View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19225_high_8 (Length: 421)
Name: NF19225_high_8
Description: NF19225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19225_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 366; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 19 - 411
Target Start/End: Complemental strand, 28938234 - 28937841
Alignment:
| Q |
19 |
gtttcgacaagacgacccaaaatattgtgctaggtataatt-atgtttgggtaaagttgtcgcacccaccttctttcctgcatgtttcctgagagattga |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||| | |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28938234 |
gtttctacaagacgacccaaaatattgtgcaatgtataatttatgtttgggtaaagttgtcgcacccaccttctttcctgcatgtttcctgagagattga |
28938135 |
T |
 |
| Q |
118 |
gagtctttattgtgctgtggtccacttgcatattatttcatgtgtttaaggttgtggtcctttattgtttgattgagttgttcaataatgtagaacacat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28938134 |
gagtctttattgtgctgtggtccacttgcatattatttcatgtgtttaaggttgtggtcctttattgtttgattgagttgttcaataatgtagaacacat |
28938035 |
T |
 |
| Q |
218 |
gtgttgtttgtcttgcttgaatctgtatttttgttgaatgttcttgtccacatatctacaagtcagttgaagtgcatgaggtcaggactcgagttaataa |
317 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28938034 |
gtgttgtttgtcttgtttgaatctgtatttttgttgaatgttcttgtccacatatctacaagtcagttgaagtgcatgaggtcaggactcgagttaataa |
28937935 |
T |
 |
| Q |
318 |
tggtggtactattgtaaattactagtcaaaatgtatgtcattgaatcactctgctcccttgcctcttgccccttgcccctctccgatgcctatg |
411 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28937934 |
tggcggtactattgtaaattactagtcaaaatgtatgtcattgaatcactctgctcccttgcctcttgccccttgcccctctccgatgcctatg |
28937841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University