View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19225_low_19 (Length: 240)
Name: NF19225_low_19
Description: NF19225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19225_low_19 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 32898172 - 32898393
Alignment:
| Q |
18 |
acatgttgcatagactacatttatatattagtatttcaaataaagttttgatagaaatagaactaaggttttatacacctacctttatttcatggtgaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32898172 |
acatgttgcatagactacatttatatattggtatttcaaataaagttttgatagaaatagaactaaggttttatacacctacctttatttcatggtgaat |
32898271 |
T |
 |
| Q |
118 |
ttgannnnnnnnnattggaagattaacatataataaatatttattttcaggtaaaagattttcatgttattgatagagatgaagacattaatacatattt |
217 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
32898272 |
ttga-ttttttttattggaagattaacgtataataaatatttattttcaggtaaaagattttcatgttatcgatagggatgaagacattaatacatattt |
32898370 |
T |
 |
| Q |
218 |
tgacaacggtagtaagattgctt |
240 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
32898371 |
tgactacggtagtaagattgctt |
32898393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University