View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19225_low_20 (Length: 239)
Name: NF19225_low_20
Description: NF19225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19225_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 49591852 - 49591631
Alignment:
| Q |
1 |
tggattatctagcaagtaaaggaaaccaagacgtgaagagattgttcaacaaattggattctacagtcctcaataggattccaaggggacctgtgaaaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49591852 |
tggattatctagcaagtaaaggaaaccaagacgtgaagagattgttcaacaaattggattctacagttctcaataggattccaaggggacctgtgaaaga |
49591753 |
T |
 |
| Q |
101 |
aaagaagtacagatgattttagatcttctttgtcacgcatgaaatataaaatatatgatgtactctctttaatttcatattcagtttactaccttaagca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49591752 |
aaagaagtacagatgattttagatcttctttgtcacgcatgaaatataaaatttatgatgtactctctttaatttcatattcagtttactaccttaagca |
49591653 |
T |
 |
| Q |
201 |
tgtaaatgaataatgttgtact |
222 |
Q |
| |
|
||||||| |||||||||||||| |
|
|
| T |
49591652 |
tgtaaatcaataatgttgtact |
49591631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University