View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19226_low_7 (Length: 232)
Name: NF19226_low_7
Description: NF19226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19226_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 29405217 - 29405437
Alignment:
| Q |
1 |
cccgacgatgataccaagcatccagagacggggagggcattatcggcgagagaagcagtggcggcacaagaagcagcagaagctgcagcggaggctgagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29405217 |
cccgacgatgataccaagcatccagagacggggagggcattatcggcgagagaagcagtggcggcacaagaagcagcagaagctgcagcggaggctgagg |
29405316 |
T |
|
| Q |
101 |
c------cgaggctgca---ggacctccgacgatgtcgttgatggatttgttaggggagactgatagagagatggggttggaagggtcaaggtatatatt |
191 |
Q |
| |
|
| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29405317 |
ctgaggccgaggctgcaacaggacctccgacgatgtcgttgatggatttgttaggggagactgatagagagatggggttggaagggtcaaggtatatatt |
29405416 |
T |
|
| Q |
192 |
aagtgatgaggaagatttttc |
212 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
29405417 |
aagtgatgaggaagatttttc |
29405437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 147 - 206
Target Start/End: Complemental strand, 19911422 - 19911363
Alignment:
| Q |
147 |
ggagactgatagagagatggggttggaagggtcaaggtatatattaagtgatgaggaaga |
206 |
Q |
| |
|
|||||||||||| |||||||| |||||||| |||||||||| || |||||||| ||||| |
|
|
| T |
19911422 |
ggagactgatagggagatgggattggaaggatcaaggtatactttgagtgatgaagaaga |
19911363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University