View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19227_high_7 (Length: 229)
Name: NF19227_high_7
Description: NF19227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19227_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 70 - 213
Target Start/End: Complemental strand, 32903347 - 32903204
Alignment:
| Q |
70 |
aattcaaatgtgaatggtagtctcatcgacgggttgaacgtttgatatataaaaaatgtgacatatattttcaatgtcttaaggttttgactcgagatgt |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| | |
|
|
| T |
32903347 |
aattcaaatgtgaatggtagtctcatcgacgggttgaacgtttgatatataaaaaatgtgacatatattttcagtgtcttaaggttttaactcgagatat |
32903248 |
T |
 |
| Q |
170 |
ggtgtcttcgtctctcttagtattggatcattgattcgttgttg |
213 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32903247 |
ggtgtcttcgtctctcgtagtattggatcattgattcgttgttg |
32903204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 113 - 158
Target Start/End: Original strand, 943455 - 943500
Alignment:
| Q |
113 |
gatatataaaaaatgtgacatatattttcaatgtcttaaggttttg |
158 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||| ||||| |
|
|
| T |
943455 |
gatatataaaaaatgtgactcatattttcaatatcttaagattttg |
943500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 110 - 151
Target Start/End: Original strand, 8228344 - 8228385
Alignment:
| Q |
110 |
tttgatatataaaaaatgtgacatatattttcaatgtcttaa |
151 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
8228344 |
tttgatttataaaagatgtgacatatattttcaatgccttaa |
8228385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University