View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19228_low_11 (Length: 271)
Name: NF19228_low_11
Description: NF19228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19228_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 10 - 254
Target Start/End: Original strand, 6472087 - 6472331
Alignment:
| Q |
10 |
attatactggaggtcttctgctctctttggacaacctttatctcctacttcagcagagcactaaattattttattgattagttatataaggagttagttt |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6472087 |
attacactggaggtcttctgctctctttggacaacctttatctcctacttcagcagagcactaaattattttattgattagttatataaggagttagttt |
6472186 |
T |
 |
| Q |
110 |
cagtcaattttgggttgttatgtgttgcttttgaaataatcgaccatttgaagttcnnnnnnnnnnnngtcaataaccatttgaagttctaacatgagta |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || |
|
|
| T |
6472187 |
cagtcaattttgggttgttatgagttgcttttgaaataatcgaccatttgaagttcttttttctttttgtcaataaccatttgaagttctaacatgaata |
6472286 |
T |
 |
| Q |
210 |
aaagtcattttctgttaggtgggatgtcaattttgggctagttat |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6472287 |
aaagtcattttctgttaggtgggatgtcaattttgggctagttat |
6472331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University