View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19228_low_13 (Length: 242)
Name: NF19228_low_13
Description: NF19228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19228_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 7 - 226
Target Start/End: Original strand, 36702332 - 36702552
Alignment:
| Q |
7 |
gagagaagaaactatcaataaacgaagactataaatattgaataacatcaagaaatgcttgattagattatatataatatcaaatctatagatgtatcca |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36702332 |
gagagtagaaactatcaataaacgaagactataaattttgaataacatcaagaaatgcttgattagattatatataatatcaaatctatagatgtatcca |
36702431 |
T |
 |
| Q |
107 |
ttttacatcataatatccaaagaagtggccatgctctaaatttcaaatccttta-tatgcaaatcaacgattttgcaggagaaaaaccaaatataaaaag |
205 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
36702432 |
ttttacatcataatatccaaagaagtgaccatgctctaaatttcaaattctttattatgcaaatcgacgattttgcaggaaaaaaaccaaatataaaaag |
36702531 |
T |
 |
| Q |
206 |
ttgttattcattgattgaaaa |
226 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
36702532 |
ttgttattcattgattgaaaa |
36702552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University