View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19228_low_14 (Length: 242)
Name: NF19228_low_14
Description: NF19228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19228_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 10118391 - 10118152
Alignment:
| Q |
1 |
aattgaagataaagtattccagttttgatgagaaatgtaagagtcaactcgtttaaattttcagtaagagaagtgctaactcaagcgtagaagttaaatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10118391 |
aattgaagataaagtattccagttttgatgagaaatgtaagagtcaactcgtttaaattttcagtaagagaagtgttaactcaagcgtagaagttaaatg |
10118292 |
T |
 |
| Q |
101 |
tggggcattcaatatgtacagcttcaaatgataagcaattgcacgatgcgtttggccccaagaaatgcaggtagaattcactaacctgcatgagagagcc |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10118291 |
tggggcattcaatatgtacagctttaaatgataagcaattgcacgatgcgtttggccccaagaaatgcaggtagaattcactaacctgcatgagagagcc |
10118192 |
T |
 |
| Q |
201 |
gtcttgcttcagattttgcgcgctggtagaaacccctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10118191 |
gtcttgcttcagattttgcgcgctggtagaaacccctttg |
10118152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 152 - 240
Target Start/End: Complemental strand, 10124914 - 10124826
Alignment:
| Q |
152 |
ttggccccaagaaatgcaggtagaattcactaacctgcatgagagagccgtcttgcttcagattttgcgcgctggtagaaacccctttg |
240 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
10124914 |
ttggccccaataaatgcatgtagaattcactaacctgcatgagaaagccgtcttgcttcagattctgcgcgctggtagaaacccttttg |
10124826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University