View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19229_high_6 (Length: 337)
Name: NF19229_high_6
Description: NF19229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19229_high_6 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 4e-63; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 177 - 337
Target Start/End: Complemental strand, 28654272 - 28654115
Alignment:
| Q |
177 |
gttagatggatcacatgattgtggtaaatatacgattttctaatgataagaatctcgtgttggcttgataacctactttgcggttaagtgaaaatatcga |
276 |
Q |
| |
|
|||||| |||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28654272 |
gttagacggatcacatgattgtgacaaatatatgattttctaatgataagaatctcgtgttggcttgataacctactttgcgtttaagtgaaaatatcga |
28654173 |
T |
 |
| Q |
277 |
acatctacattgaaaagaaatgatcatgaagtcctacaaaattataaagatatacacttgc |
337 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28654172 |
acatctacattgaaaagaaatg---atgaagtcctacaaaattataaagatatatacttgc |
28654115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 36 - 122
Target Start/End: Complemental strand, 28654380 - 28654294
Alignment:
| Q |
36 |
gaatatatcttaagtccacaatggatatagattttttgcattctagtaattagagatgccactttgaataatcatattatgtttcga |
122 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||| |||||||||| ||||| |||||| |||| |||| ||||||| |
|
|
| T |
28654380 |
gaatagatcttaagtccacaatggatatagatttcttgcattcacgtaattagagttgccaatttgaactatcaaattaagtttcga |
28654294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University