View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1922_low_5 (Length: 203)
Name: NF1922_low_5
Description: NF1922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1922_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 62; Significance: 5e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 30 - 91
Target Start/End: Complemental strand, 45740254 - 45740193
Alignment:
| Q |
30 |
attaacatatccacaacaaattgcacgttctgcattcatatatgatggaaactttgctttat |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45740254 |
attaacatatccacaacaaattgcacgttctgcattcatatatgatggaaactttgctttat |
45740193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University