View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19230_low_13 (Length: 319)
Name: NF19230_low_13
Description: NF19230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19230_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 20 - 301
Target Start/End: Original strand, 48568300 - 48568569
Alignment:
| Q |
20 |
accagcaccacgagtcgctgaagcagacaaaagcaatgatcaaaggtgtgcaccaatttaagcagactaatcactcgtgtgatttaaagcaagaaaatgt |
119 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48568300 |
accagcaccacgagtcactgaagcagacaaaagcaatgatcaaaggtgtgcaccaatttaagcagactaatcactcgtgtgatttaaagcaagaaaatgt |
48568399 |
T |
 |
| Q |
120 |
aataaaaaatctggagtataataagggaaatgaatgctatataagaaatgccatcatgtcaacttggttattgtcttggttattgtcctcgtcttccttg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
48568400 |
aataaaaaatctggagtataataagggaaatgaatgctatataagaaatgccatcatgtcaa------------cttggttattgtcctcgtcttccttg |
48568487 |
T |
 |
| Q |
220 |
gaagtaagaaagtgtccattttctttggctcggtgtttatataaatgttcttaatcaggggttatttagcttgttatatatt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48568488 |
gaagtaagaaagtgtccattttctttggctcggtgtttatataaatgttcttaatcaggggttatttagcttgttatatatt |
48568569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University