View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19230_low_21 (Length: 256)
Name: NF19230_low_21
Description: NF19230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19230_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 116 - 240
Target Start/End: Complemental strand, 39000552 - 39000434
Alignment:
| Q |
116 |
aaagaaactaggtttataaaactgtgttatatggctggcaaaggaaaggaaaatcaaatgagtatgtttgttttttgttattaaaatgttcaccaatcat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39000552 |
aaagaaactaggtttataaaactgtgttatatggctggcaaag-----gaaaatcaaatgagtatgtttgttttttgttatt-aaatgttcaccaatcat |
39000459 |
T |
 |
| Q |
216 |
gttggttgtgtggggttggaattga |
240 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39000458 |
gttggttgtgtggggttggaattga |
39000434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 18 - 81
Target Start/End: Complemental strand, 39000613 - 39000550
Alignment:
| Q |
18 |
atgaatcctaagagggctgttgctagtaggaagaaattatgaggcagatccatgtgttgtcaaa |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39000613 |
atgaatcctaagagggctgttgctagtaggaagaaattatgaggcagatccatgtgttgtcaaa |
39000550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University