View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19230_low_21 (Length: 256)

Name: NF19230_low_21
Description: NF19230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19230_low_21
NF19230_low_21
[»] chr3 (2 HSPs)
chr3 (116-240)||(39000434-39000552)
chr3 (18-81)||(39000550-39000613)


Alignment Details
Target: chr3 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 116 - 240
Target Start/End: Complemental strand, 39000552 - 39000434
Alignment:
116 aaagaaactaggtttataaaactgtgttatatggctggcaaaggaaaggaaaatcaaatgagtatgtttgttttttgttattaaaatgttcaccaatcat 215  Q
    |||||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||||||| |||||||||||||||||    
39000552 aaagaaactaggtttataaaactgtgttatatggctggcaaag-----gaaaatcaaatgagtatgtttgttttttgttatt-aaatgttcaccaatcat 39000459  T
216 gttggttgtgtggggttggaattga 240  Q
    |||||||||||||||||||||||||    
39000458 gttggttgtgtggggttggaattga 39000434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 18 - 81
Target Start/End: Complemental strand, 39000613 - 39000550
Alignment:
18 atgaatcctaagagggctgttgctagtaggaagaaattatgaggcagatccatgtgttgtcaaa 81  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39000613 atgaatcctaagagggctgttgctagtaggaagaaattatgaggcagatccatgtgttgtcaaa 39000550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University