View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19230_low_23 (Length: 253)
Name: NF19230_low_23
Description: NF19230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19230_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 12 - 234
Target Start/End: Original strand, 47619334 - 47619556
Alignment:
| Q |
12 |
aattctagtataaatatattagaagtctcaaaaacatgatcgcaatcacaattgcagccgcattggctgcatttgtttgcattgctattgctacaatatt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47619334 |
aattctagtataaatatattagaagtctcaaaaacatgatcgcaatcacaattgcagcctcattggctgcatttgtttgcattgctattgctacaatatt |
47619433 |
T |
 |
| Q |
112 |
aaagttttcaacgtaaccatgtcaatttagaacaattgggttatcaataatgaatgagtgacattaattacctgggttacaaatcttccaagaatcagaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47619434 |
aaagttttcaacgtaaccatgtcaatttagaacaattgggttatcaataatgaatgagtgacattaattacctgggttacaaatcttccaagaatcagaa |
47619533 |
T |
 |
| Q |
212 |
tcaacaatgctaccagtaggact |
234 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
47619534 |
tcaacaatgctaccagtaggact |
47619556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University