View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19230_low_31 (Length: 236)
Name: NF19230_low_31
Description: NF19230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19230_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 41401190 - 41401305
Alignment:
| Q |
1 |
tgagtaagttccatcatcattaattattattttattttctatatgtctatatcggttcaaatagaacaaatgaagaaatatataaattgagagtatttta |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||| |||||||||| |||||| ||||||||||| |||||||||||||| |||||||| ||| |
|
|
| T |
41401190 |
tgagtaagtcccatcatcattaattattattttactttctatgtgtctatatctgttcaagtagaacaaatggagaaatatataaatggagagtatctta |
41401289 |
T |
 |
| Q |
101 |
actctaaaaaaggaca |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
41401290 |
actctaaaaaaggaca |
41401305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 121 - 158
Target Start/End: Original strand, 41402435 - 41402472
Alignment:
| Q |
121 |
cgttaagatgtaggggagtctatcaaaatcagcaatta |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41402435 |
cgttaagatgtaggggagtctatcaaaatcagcaatta |
41402472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University