View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19230_low_8 (Length: 395)
Name: NF19230_low_8
Description: NF19230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19230_low_8 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 9 - 395
Target Start/End: Complemental strand, 5352764 - 5352378
Alignment:
| Q |
9 |
gattattcttgtcatatttggagtctttttcaatgttccatatgcaaagaaaataaaaagttgcaagtcacaggtgttgatttcacaggatcaaagactt |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5352764 |
gattcttcttgtcatatttggagtctttttcaatattccatatgcaaagaagataaaaagttgcaagtcacaggtgttgatttcacaggatcaaagactc |
5352665 |
T |
 |
| Q |
109 |
aggttaacttcagagattcttaacaatatcaaagttattaaactacaaggttgggaggataagtttatgaacatgatagagtcgattcgcgatgtcgagt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5352664 |
aggttaacttcagagattcttaacaatatcaaagttattaaactacaaggttgggaggataagtttatgaacatgatagagtcgattcgcgatgtcgagt |
5352565 |
T |
 |
| Q |
209 |
tcaaatggttggctcagacacagttcactaaggctttaggatcttttctttatgtttctccaccaattattggtgctgttgttttaatagcatgctctct |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5352564 |
tcaaatggttggctcagacacagttcactaaggctttaggatcttttctttacgtttctccaccaattattggtgctgttgttttaatagcatgctctct |
5352465 |
T |
 |
| Q |
309 |
ctttggtacagctccattaaatgctgcaactatcttcactgttcttgctatattgagaagtgtggcagaacctgtgaggtttatacc |
395 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5352464 |
ctttggtactgctccattaaatgctgcaactatcttcactgttcttgctatattgagaagtgtggcagaacctgtgaggtttatacc |
5352378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University