View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19232_high_12 (Length: 262)
Name: NF19232_high_12
Description: NF19232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19232_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 23 - 235
Target Start/End: Original strand, 10192259 - 10192471
Alignment:
| Q |
23 |
cgtcgaatagtatttttgaggcaaggagagcagttacactgatggggaagagatagagatagaatgtgacaaaacatagatgtttttaattttattttca |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
10192259 |
cgtcgaatagtatttttgaggcaaggagagcagttacacagatggggaagagatagagatagaatgtgacaaaacatagacgttttcaattttattttca |
10192358 |
T |
 |
| Q |
123 |
tcaaatttggggtattgatttaatataatgatatgtttttaatggttcaacggcgaaggatttaattgatccttacgctaaaattcaccttccatattat |
222 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||| ||||||||||||||||||||| | |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10192359 |
tcaaatttggggcattgatttaatctaatgatatatttttaatggttcaacggcgaggaatttaattgatcctcacgctaaaattcaccttccatattat |
10192458 |
T |
 |
| Q |
223 |
tcaactatttttt |
235 |
Q |
| |
|
||||||||||||| |
|
|
| T |
10192459 |
tcaactatttttt |
10192471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University