View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19232_high_8 (Length: 337)
Name: NF19232_high_8
Description: NF19232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19232_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 6 - 317
Target Start/End: Complemental strand, 36431096 - 36430787
Alignment:
| Q |
6 |
agaagcaaaggattaacagaaaaaatgttactcacgcccgttctaagaccaaaatcaaaatcaagaacaaaattagcatttcccaatctgttattttgta |
105 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36431096 |
agaaccaaaggattaacagaaaaaatgttactcacgcccgttctaagaccaaaatcaaaatcaagaacaaaattagcattttccaatctgttattttgta |
36430997 |
T |
 |
| Q |
106 |
ccaaccctaacctgtcttgctgcgacgattaacagtgattcgttcttgtgatttctgaaggtaaagctccaatcaactgccccaagccttgtccaaggac |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36430996 |
ccaaccctaacctgtcttgctgcgacgattaacagtgattcgttcttgtgatttctgaaggtaatgctccaatcaactgccccaagccttgtccaaggac |
36430897 |
T |
 |
| Q |
206 |
agaagtggctacgatgcaagcgcctgttcatggcaaatttatagagttttgtgattgagagaagagtgacaatcggcgtcattagctaaacaaaggtacc |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36430896 |
agaagtggctacgatgcaagcgcctgttcatggcaaatt--tagagttttgtgattgagaaaagagtgacaatcggcgtcattagctaaacaaaggtacc |
36430799 |
T |
 |
| Q |
306 |
tgtattcataca |
317 |
Q |
| |
|
|||||||||||| |
|
|
| T |
36430798 |
tgtattcataca |
36430787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University