View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19232_low_12 (Length: 262)

Name: NF19232_low_12
Description: NF19232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19232_low_12
NF19232_low_12
[»] chr5 (1 HSPs)
chr5 (23-235)||(10192259-10192471)


Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 23 - 235
Target Start/End: Original strand, 10192259 - 10192471
Alignment:
23 cgtcgaatagtatttttgaggcaaggagagcagttacactgatggggaagagatagagatagaatgtgacaaaacatagatgtttttaattttattttca 122  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||    
10192259 cgtcgaatagtatttttgaggcaaggagagcagttacacagatggggaagagatagagatagaatgtgacaaaacatagacgttttcaattttattttca 10192358  T
123 tcaaatttggggtattgatttaatataatgatatgtttttaatggttcaacggcgaaggatttaattgatccttacgctaaaattcaccttccatattat 222  Q
    |||||||||||| ||||||||||| ||||||||| ||||||||||||||||||||| | |||||||||||||| ||||||||||||||||||||||||||    
10192359 tcaaatttggggcattgatttaatctaatgatatatttttaatggttcaacggcgaggaatttaattgatcctcacgctaaaattcaccttccatattat 10192458  T
223 tcaactatttttt 235  Q
    |||||||||||||    
10192459 tcaactatttttt 10192471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University