View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19232_low_13 (Length: 249)
Name: NF19232_low_13
Description: NF19232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19232_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 42897142 - 42897363
Alignment:
| Q |
1 |
ctgttcattctctcactactcaatggttttgtctgtgataaagtccacnnnnnnnnnnnnnnnnnnnngggttagacttgtctgcagatcccagaaaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
42897142 |
ctgttcattctctcactactcaatggttttgtctgtgataaagtccactttttttccttttttgttttgggttagacttgtctgcagatcctagaaaaag |
42897241 |
T |
|
| Q |
101 |
caagacttgtaatataacaagaaacattagatccatggaacatgttataacagtcttaggattcaaaatacttcaaacataagnnnnnnncatgatcaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42897242 |
caagacttgtaatataacaagaaacattagatccatggaatatgttataacagtcttaggattcaaaatacttcaaacataagaaaaaaacatgatcaaa |
42897341 |
T |
|
| Q |
201 |
ggtttttatgtctcaacaagaa |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42897342 |
ggtttttatgtctcaacaagaa |
42897363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University