View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19232_low_4 (Length: 379)
Name: NF19232_low_4
Description: NF19232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19232_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 8e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 29 - 206
Target Start/End: Complemental strand, 42897023 - 42896850
Alignment:
| Q |
29 |
atctctagtaataatatatagtatgaacaaaaatagaggccaaattgttgaaagttgaaactgagagggagagagatatgagaaaaatgaatattggtgt |
128 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42897023 |
atctctagtaata----atagtatgaacaaaaatagagaccaaattgttcaaagttgaaactcagagggagagagatatgagaaaaatgaatattggtct |
42896928 |
T |
 |
| Q |
129 |
ctctgtgtgtgtatattatgtccaaaagaacaatagtggaaaccagaaaggcaagaggaaccctactgtataagtctc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42896927 |
ctctgtgtgtgtatattatgtccaaaagaacaatagtggaaaccagaaaggcaataggaaccctactgtataagtctc |
42896850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 42896764 - 42896720
Alignment:
| Q |
295 |
aagtgaactcaaatttttggccataataaacttttgtgtataata |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42896764 |
aagtgaactcaaatttttggccataataaaattttgtgtataata |
42896720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University