View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19232_low_9 (Length: 294)
Name: NF19232_low_9
Description: NF19232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19232_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 28154683 - 28154879
Alignment:
| Q |
1 |
aacaaaatcaacaatgtctgcagataccctactacataataattgatgnnnnnnnngagttgctcatttttactaaatgaaaaaatggcaaaagaaattc |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28154683 |
aacaaaatcaacaatatctgcagataccctactacataataattgatgaaaaaaa-gtgttgctcatttttactaaatgaaaaaatggcaaaagaaattc |
28154781 |
T |
 |
| Q |
101 |
aaatgacagctagcaagagtcaatggtgactgatacacgagctcaactacatggttaattaattgaaacacgtggcaggtgttgttcttgtagcagta |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28154782 |
aaatgacagctagcaagagtcaatggtgactgatacacgagctcaactacatggttaattaattgaaacacgtggcaggtgttgttcttgtagtagta |
28154879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 222 - 283
Target Start/End: Original strand, 28154888 - 28154949
Alignment:
| Q |
222 |
cctcaccacaactttaannnnnnngtgaaatgccatttatatcactcttctcttttgccttt |
283 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28154888 |
cctcaccacaactttaatttttttgtgaaatgccatttatatcactcttctcttttgccttt |
28154949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University