View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19236_high_37 (Length: 255)

Name: NF19236_high_37
Description: NF19236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19236_high_37
NF19236_high_37
[»] chr4 (1 HSPs)
chr4 (100-243)||(28678554-28678697)


Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 100 - 243
Target Start/End: Original strand, 28678554 - 28678697
Alignment:
100 cacaaatactcatgaataatttaatttaacaattgaagagaaacagtaaccttaacacgtcttgtagcagcaactttctcaactttattgacaaattgat 199  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28678554 cacaaatactcatgaataatttaatttaacaattgaagataaacagtaaccttaacacgtcttgtagcagcaactttctcaactttattgacaaattgat 28678653  T
200 tgaaagagtaataaggtagcaaacgagagtgccagtcagagtat 243  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
28678654 tgaaagagtaataaggtagcaaacgagagtgccagtcagagtat 28678697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University