View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19236_high_44 (Length: 238)
Name: NF19236_high_44
Description: NF19236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19236_high_44 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 10 - 238
Target Start/End: Complemental strand, 7802474 - 7802246
Alignment:
| Q |
10 |
catcatcaatgtccatcttagtgatgaatgtccagttcttagcccatttctttgataaaacagaagttctaactgcatctcttgttggcagaaaagataa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7802474 |
catcatcaatgtccatcttagtgatgaatgtccagttcttagcccatttctttgataaaacagaagttctaactgcatctcttgttggcagaaaagataa |
7802375 |
T |
|
| Q |
110 |
gatttgacctataagctttggtgatagctttctgtggattatgtcttcttcaaactccatgctttcctttgtctaattctaatatcaaacacaaaaaaga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7802374 |
gatttgacctataagctttggtgatagctttctgtggattatgtcttcttcaaactccatgctttcctttgtctaattctaatatcaaacacaaaaaaga |
7802275 |
T |
|
| Q |
210 |
acatcattgtgtgaaagaaaacaaacatt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7802274 |
acatcattgtgtgaaagaaaacaaacatt |
7802246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 53 - 157
Target Start/End: Complemental strand, 7794371 - 7794264
Alignment:
| Q |
53 |
ccatttctttgataaaacagaagttctaactgcatctcttgttggcagaaaagataagatttgacctataagctttggt---gatagctttctgtggatt |
149 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||| || |||| |||||||| |||| |||||||| ||||||| | |
|
|
| T |
7794371 |
ccatttctttgacaaaacagaagtcctaactgcatctgttgttggcagaaaagataaaatgtgacttataagctgtggttcagatagcttgctgtggagt |
7794272 |
T |
|
| Q |
150 |
atgtcttc |
157 |
Q |
| |
|
| |||||| |
|
|
| T |
7794271 |
acgtcttc |
7794264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University