View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19236_low_25 (Length: 322)
Name: NF19236_low_25
Description: NF19236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19236_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 12 - 127
Target Start/End: Complemental strand, 49432574 - 49432459
Alignment:
| Q |
12 |
caaagggaaggtactctatgaaataataccattttttggtagttttgtaacgacgctcgttccatactctgcaaagttagcaatttctgattgtgcttgt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49432574 |
caaagggaaggtactctatgaaataataccattttttggtagttttgtaacgacgctcgttccatactctgcaaagttagcaatttctgattgtgcttgt |
49432475 |
T |
 |
| Q |
112 |
aatatgatatttctag |
127 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
49432474 |
aatatgatatttctag |
49432459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 220 - 304
Target Start/End: Complemental strand, 49432366 - 49432282
Alignment:
| Q |
220 |
ggcaagagttaagtaaataacaatgttcaaaatgtgtactcgtccataatagtatttttagtattttaatacttttacttgcatt |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49432366 |
ggcaagagttaagtaaataacaatgttcaaaatgtgtactcgtccataatagtatttttagtattttaatacttttacttgcatt |
49432282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University