View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19236_low_35 (Length: 267)
Name: NF19236_low_35
Description: NF19236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19236_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 18 - 129
Target Start/End: Original strand, 4184269 - 4184380
Alignment:
| Q |
18 |
atatggtattcaaagtttgaattctaattgaaagaggtgcttacatttagtgtctggaaatgtcttgaagaaacattcggaaaaaattgaaactcttaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
4184269 |
atatggtattcaaagtttgaattctaattgaaagaggtgcttacatttagtgtctgaaaatgtctcgaagaaacattcggaaaaaactgaaactcttaac |
4184368 |
T |
|
| Q |
118 |
aagccacaactt |
129 |
Q |
| |
|
|||||||||||| |
|
|
| T |
4184369 |
aagccacaactt |
4184380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 166 - 252
Target Start/End: Original strand, 4184377 - 4184463
Alignment:
| Q |
166 |
actttctctccaaatcggtctctaaactatttaaacatgttttaaggtctttaaactattcctccatccaactatttagtctctctg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4184377 |
actttctctccaaatcggtctctaaactatttaaacatgttttaaggtctttaaactattcctccatccaactatttagtctctctg |
4184463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University