View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19236_low_38 (Length: 255)
Name: NF19236_low_38
Description: NF19236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19236_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 100 - 243
Target Start/End: Original strand, 28678554 - 28678697
Alignment:
| Q |
100 |
cacaaatactcatgaataatttaatttaacaattgaagagaaacagtaaccttaacacgtcttgtagcagcaactttctcaactttattgacaaattgat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28678554 |
cacaaatactcatgaataatttaatttaacaattgaagataaacagtaaccttaacacgtcttgtagcagcaactttctcaactttattgacaaattgat |
28678653 |
T |
 |
| Q |
200 |
tgaaagagtaataaggtagcaaacgagagtgccagtcagagtat |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28678654 |
tgaaagagtaataaggtagcaaacgagagtgccagtcagagtat |
28678697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University