View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19236_low_42 (Length: 241)
Name: NF19236_low_42
Description: NF19236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19236_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 17 - 230
Target Start/End: Complemental strand, 4516226 - 4516013
Alignment:
| Q |
17 |
ctttccaccaaaagctcttgatactctcacaattcttggatctttcaatcttggccattgtgatgaagctaaggagcttgatgatggtgaattagccttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
4516226 |
ctttccaccaaaagctcttgatactcttacaattcttggatctttcaatcttggccattgtgatgaagctaaggagcttgatgacggtgaattcgccttt |
4516127 |
T |
 |
| Q |
117 |
tctttttcatgatcgtttgaattttgatgaacctcttgtttcaatggaaaatcttcttttgaattcttattcatcttgtaatgtccttcattgttggttg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4516126 |
tctttttcatgatcgtttgaattttgatgaacctcttgtttcaatggaaaatcttcttttgaattcttattcatcttgtaatgtccttcattgttggttg |
4516027 |
T |
 |
| Q |
217 |
ctagatggagaatt |
230 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
4516026 |
ctaaatggagaatt |
4516013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University