View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19236_low_55 (Length: 210)
Name: NF19236_low_55
Description: NF19236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19236_low_55 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 15 - 190
Target Start/End: Complemental strand, 44014488 - 44014313
Alignment:
| Q |
15 |
acatcactcaacaaactcaaacacagactctctgaaatcttcttccctgatgatcctttacaccgtttcaaaaaccaaccatcttttacaaagtttcttc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44014488 |
acatcactcaacaaactcaaacacagactctctgaaatcttcttccccgatgatcctttacaccgtttcaaaaaccaaccatcttttacaaagtttcttc |
44014389 |
T |
|
| Q |
115 |
ttacccttcaattcttgttccccatttttcaatggggttctcagtatactctcacccttcttcgttctgatgtcat |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44014388 |
ttacccttcaattcttgttccccatttttcaatggggttctcagtatactctcacccttcttcgttctgatgtcat |
44014313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 39 - 162
Target Start/End: Original strand, 3172739 - 3172862
Alignment:
| Q |
39 |
agactctctgaaatcttcttccctgatgatcctttacaccgtttcaaaaaccaaccatcttttacaaagtttcttcttacccttcaattcttgttcccca |
138 |
Q |
| |
|
||||||||||||||||| || |||||||| ||||| || | |||||||||||| | || || |||||||||||||| | ||||||| | |||| || | |
|
|
| T |
3172739 |
agactctctgaaatcttttttcctgatgacccttttcatggattcaaaaaccaaacttccttcacaaagtttcttctggctcttcaatacatgtttccga |
3172838 |
T |
|
| Q |
139 |
tttttcaatggggttctcagtata |
162 |
Q |
| |
|
|||||||||||||| ||||||||| |
|
|
| T |
3172839 |
tttttcaatggggtcctcagtata |
3172862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University